Searching DNA

[Anon]

Hello,

I a novice PHP'er and I am trying to find all matches of a short piece of DNA in a longer piece. The catch is, the data I want returned is the query AND a given number of bases following the match.

E.g. in my DNA sequence is
aaccaccttttgggtttcctttgggaaatttttt

and I want to find all of the "cc" AND the following 6 nucleotides I should get
ccaccttt
ccttttgg
cctttggg

The code I'm trying is:
<?php
$input = "aaccaccttttgggtttcctttgggaaattttttt";

$search_string = "/cc.{6}/";

preg_match_all($search_string, $input, $possible_matches);

$total = count($possible_matches[0]);

echo "Total number of possible matches = ".$total."<P>";
#This returns the 8 character string cc......
for ($i = 0; $i < $total; $i++) {
echo "Match ".$i."
".$possible_matches[0][$i].
"<P>";}

$search_string = "/cc/";

preg_match_all($search_string, $input, $possible_matches);

$total = count($possible_matches[0]);
#This gives the total # of cc's in the DNA
echo "There are really = ".$total." matches for cc in this DNA<P>";

for ($i = 0; $i < $total; $i++) {
echo "Match ".$i."
".$possible_matches[0][$i].
"<P>";}

?>

Clearly preg_match_all finds the string, then begins looking for the next match AFTER the string it just found. This is even more problematic with something like aacccttttttt
where there are clearly 2 instances of cc, but preg_match_all("/cc/", $input, $possible_matches);
finds only th first.

Any advice on a different function, or way to approach this problem would be appreciated.

Thanks,
Chris

[slug58]

give this a try, you may want to clean it up some what but it does work.

good luck!!

---

<?php

print "aaccaccttttgggtttcctttgggaaattttttt<br>";

$input = "aaccaccttttgggtttcctttgggaaattttttt";

$pos = 0;

while($pos < strlen($input)){

$pos = strpos($input, "cc", $pos);

if($pos === false){
break;
}
print "<br>position: $pos <br>";

$str = substr($input, $pos, 8);

print "<br>string: $str<br><br>";

$pos = $pos + 2;

}
?>

[Anon]

That code was exactly what I needed. I just changed $pos = $pos + 2; to $pos = $pos + 1; and everything is perfect.

Thanks again!

Chris

[slug58]

you're welcome, it was a learning experience for me also.

good luck!!