trying to replicate PHP5's str_split function in PHP 4

vikette

I'm trying to replicate PHP5's str_split function in PHP 4, adapting some coding I found in the manual which seems straightforward. I want the string split into groups of 3 letters and then output as ATG GTG AGC, etc.

Get the msg:
Warning: Invalid argument supplied for foreach()

What am I missing?
__

$string = "ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGAC
GGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTAC
GGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACC
";
$split_length = 3;

if(!function_exists('str_split')){
   function str_split($string,$split_length){

   $cnt = strlen($string);

   for ($i=0; $i < $cnt; $i += $split_length)
       $chunks[]= substr($str,$i,$split_length);    

   return $chunks;
   }
} 


$chunks = str_split($string,$split_length);

foreach ($chunks as $chunk) {
echo $chunk . " ";
}

_theworks

i dono but maybe try

$chunks[$i]= substr($str,$i,$split_length);

instead of

$chunks[]= substr($str,$i,$split_length);

vikette

Same error msg.

mchip

change this line:

$chunks[]= substr($str,$i,$split_length);

$chunks[]= substr($string,$i,$split_length);

_theworks

haha im so silly :queasy:

thorpe

this line...

$chunks[]= substr($str,$i,$split_length);

should be

$chunks[]= substr($string,$i,$split_length);

hehe... too late. but while i was testing this code there where a few other error two. some of the array elements only end up with one or two characters. seems pretty random too.

vikette

Dang. Thanks!

vikette

The random 1 or 2 characters where due to spaces at the end of the some lines - just a copying & pasting issue.

Weedpacket

On the wild chance that ACGT are the only characters that are going to appear in the string:

$chunks = explode(':', chunk_split($string, 3, ':'));
array_pop($chunks); // Beware the zero-length dangler

vikette

That worked 1st time and it's far too easy. Must be something wrong with it. It's probably crashing servers in Russia or something.

Your "wild chance" was right, Weedpacket, ACGT are the only letters DNA scientists use. They are sooo unimaginative. Splitting them into 3's is important because each grouping makes up a specific protein or something.